Printer Friendly
The Free Library
6,672,202 articles and books
Member login
User name  
Password 
 
Join us Forgot password?

[delta]-aminolevulinic acid dehydratase polymorphism and risk of brain tumors in adults.


The enzyme [delta]-aminolevulinic acid dehydratase dehydratase /de·hy·dra·tase/ (de-hi´drah-tas) a common name for a hydro-lyase.

de·hy·dra·tase
n.
 (ALAD ALAD

d-aminolevulinic acid dehydratase.
), which catalyzes the second step of heme synthesis, can be inhibited by several chemicals, including lead, a potential risk factor for brain tumors, particularly meningioma meningioma /me·nin·gi·o·ma/ (me-nin?je-o´mah) a benign, slow-growing tumor of the meninges, usually next to the dura mater, which may invade the skull or cause hyperostosis, and often causes increased intracranial pressure; it is usually . In this study we examined whether the ALAD G177C polymorphism in the gene coding for ALAD is associated with risk of intracranial intracranial /in·tra·cra·ni·al/ (-kra´ne-al) within the cranium.

in·tra·cra·ni·al
adj.
Within the cranium.
 tumors of the brain and nervous system. We use data from a case-control study case-control study,
n an investigation employing an epidemiologic approach in which previously existing incidents of a medical condition are used in lieu of gathering new information from a randomized population.
 with 782 incident brain tumor cases and 799 controls frequency matched on hospital, age, sex, race/ethnicity, and residential proximity to the hospital. Blood samples were drawn and DNA DNA: see nucleic acid.
DNA
 or deoxyribonucleic acid

One of two types of nucleic acid (the other is RNA); a complex organic compound found in all living cells and many viruses. It is the chemical substance of genes.
 subsequently sent for genotyping for 73% of subjects. ALAD genotype was determined for 94% of these samples (355 glioma glioma /gli·o·ma/ (gli-o´mah) a tumor composed of neuroglia in any of its states of development; sometimes extended to include all intrinsic neoplasms of the brain and spinal cord, as astrocytomas, ependymomas, etc. , 151 meningioma, 67 acoustic neuroma Acoustic Neuroma Definition

An acoustic neuroma is a benign tumor involving cells of the myelin sheath that surrounds the vestibulocochlear nerve (eighth cranial nerve).
, and 505 controls). Having one or more copy of the ALAD2 allele allele (əlēl`): see genetics.
allele

Any one of two or more alternative forms of a gene that may occur alternatively at a given site on a chromosome.
 was associated with increased risk for meningioma [odds ratio (OR) = 1.6; 95% confidence interval confidence interval,
n a statistical device used to determine the range within which an acceptable datum would fall. Confidence intervals are usually expressed in percentages, typically 95% or 99%.
 (CI), 1.0-2.6], with the association appearing stronger in males (OR = 3.5; 95% CI, 1.3-9.2) than in females (OR = 1.2; 95% CI, 0.7-2.2). No increased risk associated with the ALAD2 variant was observed for glioma or acoustic neuroma. These findings suggest that the ALAD2 allele may increase genetic susceptibility to meningioma. Key words: ALAD, brain, case-control, meningioma, polymorphism, tumor. doi:10.1289/ehp.7986 available via http://dx.doi.org/[Online 10 May 2005]

**********

The ALAD gene codes for the enzyme [delta]-aminolevulinic acid dehydratase (ALAD), which catalyzes the second step of heme synthesis involving the condensation of two molecules of aminolevulinic acid aminolevulinic acid /ami·no·lev·u·lin·ic ac·id/ (ALA) (-lev?u-lin´ik) d-aminolevulinic acid; an intermediate in the synthesis of heme; blood and urinary levels are increased in lead poisoning, and urinary levels are increased in some  (ALA) to form porphobilinogen. The most commonly studied polymorphism in the gene, ALAD G177C (dbSNP ID: rs1800435) contains a G-to-C transversion trans·ver·sion
n.
Eruption of a tooth in a position normally occupied by another.


transversion,
n eruption of a tooth in the wrong position
 at position 177 of the coding region, resulting in the substitution of asparagine asparagine (əspâr`əjēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer participates in the biosynthesis of mammalian proteins.  for lysine lysine (lī`sēn), organic compound, one of the 20 amino acids commonly found in animal proteins. Only the l-stereoisomer appears in mammalian protein. . ALAD G177C has two codominant co·dom·i·nant
adj.
Of or relating to an equal degree of dominance of two genes, both being expressed in the phenotype of the individual.
 alleles: ALAD1 and ALAD2 (Battistuzzi et al. 1981), with an ALAD2 allele prevalence of approximately 10% (range, 6-20%) in Caucasian populations, 3-11% in Asian populations, and 3% in African-American populations (Kelada et al. 2001).

Although ALAD can be inhibited by a variety of chemicals, including lead, trichloroethylene trichloroethylene /tri·chlo·ro·eth·y·lene/ (-eth´i-len) a clear, mobile liquid used as an industrial solvent; formerly used as an inhalant anesthetic.

tri·chlo·ro·eth·yl·ene
n.
, bromobenzene, and styrene sty·rene
n.
A colorless oily liquid from which polystyrenes, plastics, and synthetic rubber are produced. Also called vinylbenzene.
 (Fujita et al. 2002), polymorphic differences in enzyme binding or chemical uptake have been examined most extensively for lead. On average, individuals with the ALAD2 allele have higher blood lead levels than do ALAD1 homozygotes, probably due to tighter binding of lead by the ALAD2 enzyme (Alexander et al. 1998; Bergdahl et al. 1997; Fleming et al. 1998; Hsieh et al. 2000; Shen Shen, in the Bible, place, perhaps close to Bethel, near which Samuel set up the stone Ebenezer.  et al. 2001; Wetmur et al. 1991; Ziemsen et al. 1986). Previous studies in animals and humans indicate that exposure to lead may increase the risk of brain tumors [International Agency for Research on Cancer The International Agency for Research on Cancer (IARC, or CIRC in its French acronym) is an intergovernmental agency forming part of the World Health Organisation of the United Nations.

Its main offices are in Lyon, France.
 (IARC) 1987; Silbergeld 2003; Steenland and Boffetta 2000], particularly meningioma (Cocco et al. 1999; Hu et al. 1999; Navas-Acien et al. 2002).

Given that the ALAD G177C polymorphism affects the toxicokinetics of lead in the body, and that exposure to lead may increase the risk of adult brain tumors, we postulated a possible association of ALAD G177C genotype and risk of intracranial tumors of the brain and nervous system (hereafter referred to as brain tumors). Analyses were conducted using data from a hospital-based case-control study of brain tumors conducted by the National Cancer Institute (NCI See Liberate. ) between 1994 and 1998.

Materials and Methods

Study population. Subjects for the brain tumor study were enrolled from 1994 through 1998 from three hospitals specializing in brain tumor treatment, located in Phoenix, Arizona; Boston, Massachusetts; and Pittsburgh, Pennsylvania. The study protocol was approved by the institutional review board of each participating institution. Study methods have been described in detail elsewhere (Inskip et al. 2001).

Eligible cases for the parent study were [greater than or equal to] 18 years of age with a first intracranial glioma, meningioma, or acoustic neuroma diagnosed during or within the 8 weeks preceding hospitalization. Ninety-two percent of eligible brain tumor patients agreed to participate in the study. All diagnosed cases of glioma and meningioma were confirmed by microscopy, as were 96% of acoustic neuroma cases. A total of 489 subjects with glioma, 197 subjects with meningioma, and 96 subjects with acoustic neuroma were enrolled.

Controls were patients admitted to the same hospitals as cases for a variety of non-neoplastic conditions, with the most common being injuries (25%), circulatory system disorders (22%), musculoskeletal disorders (22%), and digestive disorders (12%). More than 90% of patients were interviewed within 1 year of symptom onset. Control subjects were frequency matched in a 1:1 ratio to all brain tumor cases based on hospital, age, sex, race/ethnicity, and proximity of residence to the hospital; 799 controls (86% of all contacted controls) were enrolled.

Informed written consent was obtained from all cases and controls. Blood samples were collected and sent for genotyping for 73% of all subjects: 382 subjects with glioma (78%), 158 subjects with meningioma (80%), 71 subjects with acoustic neuroma (74%), and 540 control subjects (68%). The main obstacle to obtaining blood samples was subject refusal, with nonparticipation in the blood draw being higher for control subjects than for case subjects.

Shortly after hospitalization, a trained research nurse administered a structured in-person interview for each subject. Information on known or possible risk factors for brain tumors (including a detailed occupational history) was collected for all subjects.

Processing of blood samples. DNA was extracted from the peripheral white blood cells White blood cells
A group of several cell types that occur in the bloodstream and are essential for a properly functioning immune system.

Mentioned in: Abscess Incision & Drainage, Bone Marrow Transplantation, Complement Deficiencies
 (buffy coat or granulocytes Granulocytes
White blood cells.

Mentioned in: Blood Donation and Registry

granulocytes (granˑ·y
) of blood samples using a phenol-chloroform method described by Daly et al. (1996). ALAD genotyping was conducted by the NCI's Core Genotyping Facility using a medium-throughput TaqMan assay (Applied Biosystems, Foster City, CA).

Reactions for the assay were done in a 384 (96 x 4)-well plate format. Lyophilized ly·oph·i·lize  
tr.v. ly·oph·i·lized, ly·oph·i·liz·ing, ly·oph·i·liz·es
To freeze-dry (blood plasma or other biological substances).



[lyophil(ic) + -ize.
 sample DNA (10 ng) was used for a 5 [micro]L TaqMan reaction. Four Coriell DNA controls (Coriell Cell Repositories, Camden, NJ) for each genotype as well as no-template controls (NTCs) were put on the plate along with the samples; 2.5 [micro]L of the 2X Universal Master Mix (Applied Biosystems), 200 nM of each primer, and 900 nM of each probe was used in the reaction. Probe 1 (TGTGAAGCGGCTGG), specific to the ALAD1 allele, contained the FAM FAM 5-FU, adriamycin/doxorubicin, mitomycin C Oncology A chemotherapeutic regimen used with varying degrees of failure for advanced gastric CA. See Stomach cancer.  dye reporter. Probe 2 (TGTGAACCGGCTGG) was specific to the ALAD2 allele and contained the VIC VIC Victor
VIC Victoria (State of Australia)
VIC Victory
VIC Victim (police slang)
VIC Vicinity
VIC Vicar
VIC Vicarage
VIC Virtual Information Center (APAN) 
 dye reporter. The primers used were primers F (TGCCTTCCTTCAACCCCTCTA) and R (CAAGGGCCTCAGCATCTCTT). Step 1 of the assay-specific thermocycling process involved 2 min of UNG UNG Unguent (ointment, medical)
UNG UNG's not GNU
 (uracil-DNA glycosylase) activation using AmpErase UNG (Applied Biosystems) at 50[degrees]C. This was followed by 10 min of enzyme activation at 95[degrees]C (step 2), 0.30 sec of template denaturation denaturation, term used to describe the loss of native, higher-order structure of protein molecules in solution. Most globular proteins exhibit complicated three-dimensional folding described as secondary, tertiary, and quarternary structures.  at 92[degrees]C if using 3'MGB quencher quench  
tr.v. quenched, quench·ing, quench·es
1. To put out (a fire, for example); extinguish.

2. To suppress; squelch:
, or at 95[degrees]C if using 3'TAMRA quencher (step 3), and 1 min of assay-specific annealing annealing (ənēl`ĭng), process in which glass, metals, and other materials are treated to render them less brittle and more workable.  at 60[degrees]C (step 4). Steps 3 and 4 were repeated 49 times, after which the reaction was held at 4[degrees]C. The plate was then read on the ABI Abi (ā`bī) [short for Abijah], in the Bible, King Hezekiah's mother.


(Application Binary Interface) A specification for a specific hardware platform combined with the operating system.
 7900HT sequence detection system (Applied Biosystems), and the results of the allelic al·lele  
n.
One member of a pair or series of genes that occupy a specific position on a specific chromosome.



[German Allel, short for Allelomorph, allelomorph, from English
 discrimination were graphed as a scatter plot of allele 1 reaction versus allele 2 reaction (SDS 1. (company) SDS - Scientific Data Systems.
2. (tool) SDS - Schema Definition Set.
 Software; Applied Biosystems), with each well of the 384-well plate represented as a spot on the graph. Four distinct clusters on the allelic plot represented the NTCs and three possible genotypes, ALAD1-1, ALAD2-2, and ALAD1-2, respectively. Calls were determined manually by a technician using SDS software.

Quality control specimens for the study included multiple samples from three individuals who were not study subjects (QC-A, n = 34; QC-B, n = 20; QC-C, n = 15) and 76 duplicates from study subjects. These specimens were submitted for genotyping in a masked fashion and were collected and processed in a manner identical to that for study samples. Ninety-eight percent agreement was achieved between the three nonstudy replicates. The concordance rate for study duplicates (study samples compared with masked relabels) was 87% for glioma, 100% for meningioma, 85% for acoustic neuroma, and 89% for controls.

Using a conservative call strategy that labeled a call as missing if the genotype was unclear, ALAD genotyping was successfully conducted for 94% of samples (93% of gliomas, 96% of meningiomas, 94% of acoustic neuromas, and 94% of controls). Missing values (noncalls) were generally equally likely to be from case or control samples.

Statistical analysis. We assessed statistically significant departure from Hardy-Weinberg equilibrium for controls using the chi-square test. Unconditional logistic regression was used to estimate odds ratios (ORs) and calculate 95% confidence intervals (CIs) for the effect of the variant ALAD2 allele, adjusting for study matching factors. We entered adjustment variables as indicator variables in the following categories: age in years (18-29, 30-39, 40-49, 50-59, 60-69, 70-79, 80-99); race/ethnicity (non-Hispanic white, Hispanic, African-American, other); sex (male, female); hospital (Phoenix, Boston, Pittsburgh); and residential proximity to the hospital in miles (0-4, 5-14, 15-29, 30-49, [greater than or equal to] 50). Because the small number of ALAD2-2 homozygotes precluded accurate estimation of risk for ALAD1-2 heterozygotes and ALAD2-2 homozygotes separately, these categories were combined for analysis. ALAD1-1 homozygotes were the reference group. In order to test for the influence of control group composition on the results, the models were run excluding each major category of control discharge diagnosis, one at a time.

Results

The distribution of demographic characteristics for genotyped subjects (Table 1) was comparable with the distribution for all study subjects (Inskip et al. 2001). Most demographic characteristics were distributed similarly for brain tumor cases and controls. Relative to controls, subjects with glioma were proportionately more often male, whereas subjects with meningioma and acoustic neuroma were more often female. Differences between individual tumor group and control group distributions were mostly due to the matching of controls for all tumors combined rather than for specific tumor subgroups.

Study participants in the youngest and oldest age brackets were less likely to have given a blood sample, as were control subjects who lived closest to the hospital. Brain tumor cases that were male, of "other" race/ethnicity, or from the Phoenix study site were also less likely to have given a blood sample (results not shown).

No significant departure from Hardy-Weinberg equilibrium was detected for controls (p = 0.3). Table 2 summarizes the association between ALAD G177C genotype and risk of each brain tumor type. The odds of meningioma were significantly higher for individuals possessing any ALAD2 allele compared with ALAD1-1 homozygotes (OR = 1.6; 95% CI, 1.0-2.6). This risk did not differ markedly when different control subgroups (musculoskeletal disorders, circulatory disorders, digestive disorders, or trauma) were excluded. Although the observed association between ALAD2 and meningioma appeared stronger in males (OR = 3.5; 95% CI, 1.3-9.2) than in females (OR = 1.2; 95% CI, 0.7-2.2), the sample size for the sex-specific estimates was small, with only 10 male and 25 female meningioma cases possessing the variant allele. No increased risk associated with the ALAD2 variant was observed for glioma or acoustic neuroma.

Discussion

We found that the ALAD2 allele of the G177C polymorphism was associated with increased risk of meningioma, especially in males. Confirmation of our findings will require replication in other studies with a larger number of meningioma cases. If risk of meningioma is truly increased in individuals with the ALAD2 allele, the question arises as to whether the effect depends upon exogenous chemical exposures that act on the heme synthesis pathway or is independent of such exposures. A direct effect of the ALAD2 polymorphism might be indicated if the ALAD2 allele has lower enzyme activity than the ALAD1 allele, given that the precursor ALA is thought to be neurotoxic neurotoxic

pertaining to or emanating from a neurotoxin.


neurotoxic state
a case of poisoning by a neurotoxin.


neurotoxic adjective
 and genotoxic genotoxic /ge·no·tox·ic/ (je´no-tok?sik) damaging to DNA: pertaining to agents known to damage DNA, thereby causing mutations, which can result in cancer.

ge·no·tox·ic
adj.
 (Silbergeld 2003). However, ALAD enzyme activity does not appear significantly different for the two alleles (Battistuzzi et al. 1981). Alternatively, it is possible that the increased risk of meningioma in ALAD2 individuals arises in the presence of chemicals that influence the heme synthesis pathway. Several chemicals have been shown to inhibit ALAD enzyme activity, including lead, trichloroethylene, bromobenzene, and styrene (Fujita et al. 2002). Polymorphic differences in enzyme binding or chemical uptake have been examined most extensively for lead, and individuals with the ALAD2 allele are generally reported to have higher blood lead levels than are individuals with the ALAD1 allele (Alexander et al. 1998; Bergdahl et al. 1997; Fleming et al. 1998; Hsieh et al. 2000; Shen et al. 2001; Wetmur et al. 1991; Ziemsen et al. 1986).

The observation that the relationship between ALAD2 and risk of meningioma was stronger in men than in women could be due to biologic differences or differential exposure to a chemical agent modified by ALAD genotype. Given the small number of male meningioma cases with the variant allele, we also cannot rule out the possibility that the observed effect modification is due to chance.

The specific question of ALAD genotype and brain tumor risk has not been addressed previously in the literature. In a previously published analysis of this same data set, we found elevated risk of meningioma in individuals who had worked in military occupations or as autobody painters, designers and decorators, industrial production supervisors, teachers, or managers (Rajaraman et al. 2004). Aside from teachers and managers, all of these occupations have potential exposure to lead, suggesting that lead might be implicated im·pli·cate  
tr.v. im·pli·cat·ed, im·pli·cat·ing, im·pli·cates
1. To involve or connect intimately or incriminatingly: evidence that implicates others in the plot.

2.
 in meningioma risk. Our observation of increased risk with the ALAD2 variant for meningioma, but not for glioma or acoustic neuroma, parallels the observation that reports of increased risk of brain tumor with lead have been more consistent for meningioma (Cocco et al. 1999; Hu et al. 1999; Navas-Acien et al. 2002) than for glioma or for all brain tumors combined. However, the role of lead in the observed association between ALAD genotype and meningioma can be meaningfully addressed only when data on both ALAD genotype and individual lead exposure are available.

In a study with hospital controls, study results can be biased if the exposure under study is associated with conditions enrolled in the control series (Miettinen 1985). To assess for such a bias, we conducted a sensitivity analysis by excluding one major control subgroup at a time from the analysis. Systematically excluding control subgroups did not change observed ORs appreciably and resulted, if anything, in slightly stronger evidence of an association between ALAD2 and meningioma when circulatory or digestive disorders were excluded. If use of hospital controls introduced a bias in the observed OR, therefore, the likely direction of the bias was toward the null.

The relatively low concordance rate for study duplicates is another potential concern. However, the concordance concordance /con·cor·dance/ (-kord´ins) in genetics, the occurrence of a given trait in both members of a twin pair.concor´dant

con·cor·dance
n.
 for duplicates from meningioma cases was 100%, so our observed association for meningioma was probably not affected by genotyping concerns. Moreover, if we assume that 10% nondifferential misclassification did occur, this would have biased our findings toward the null, making our observed association a conservative estimate.

We chose to study the ALAD polymorphism based on a priori biologic and functional considerations and not by screening a large number of associations. Nonetheless, the possibility that our findings are due to chance cannot be ruled out. These findings should be viewed as hypothesis generating and need to be confirmed by replication in other studies.

Although our study had limited power for evaluating risk with respect to subtypes of tumor, it remains one of the largest case-control studies of brain tumors to date. Aside from a small percentage of brain tumors that can be explained by familial syndromes or exposure to ionizing radiation, very little is known about the etiology of brain tumors (Preston-Martin and Mack 1996; Wrensch et al. 2002). In order to clarify the role of lead (or other chemicals) in the observed relationship between ALAD genotype and risk of meningioma, it will be important to conduct a detailed exposure assessment and evaluate the joint effect of exposure and ALAD genotype in this, or another, study population.

The authors declare they have no competing financial interests.

Received 2 February 2005; accepted 10 May 2005.

REFERENCES

Alexander OH, Checkoway H, Costa-Mallen P, Faustman EM, Woods JS, Kelsey KT, et al. 1998. Interaction of blood lead and [delta]-aminolevulinic acid dehydratase genotype on markers of heme synthesis and sperm production in lead smelter workers. Environ Health Perspect 108:213-216.

Battistuzzi G, Petrucci R, Silvagni L, Urbani F, Caiola S. 1981. Delta-aminolevulinate dehydrase: a new genetic polymorphism in man. Ann Rum Genet genet: see civet.  45(Pt 3):223-229.

Bergdahl I, Grubb A, Schutz A, Desnick R, Wetmur J, Sassa S, et al. 1997. Lead binding to delta-aminolevulinic acid dehydratase delta-aminolevulinic acid dehydratase

an enzyme of which the concentration in erythrocytes is a widely used indicator of the level of lead poisoning in animals.
 (ALAD) in human erythrocytes Erythrocytes
Red blood cells.

Mentioned in: Bartonellosis

erythrocytes (ē·rithˑ·rō·sīts),
n.pl red blood cells.
. Pharmacol Toxicol 81(4):153-158.

Cocco P, Heineman E, Dosemeci M. 1999. Occupational risk factors for cancer of the central nervous system (CNS See Continuous net settlement.

CNS

See continuous net settlement (CNS).
) among US women. Am J Ind Med 36(1):70-74.

Daly A, Steen V, Fairbrother K, Idle J. 1996. CYP CYP

In currencies, this is the abbreviation for the Cyprus Pound.

Notes:
The currency market, also known as the Foreign Exchange market, is the largest financial market in the world, with a daily average volume of over US $1 trillion.
2D8 multiallelism. Methods Enzymol 272:199-210.

Fleming D, Chettle D, Wetmur J, Desnick R, Robin J, Boulay D, et al. 1998. Effect of the delta-aminolevulinate dehydratase polymorphism on the accumulation of lead in bone and blood in lead smelter workers. Environ Res 77(1):49-61.

Fujita H, Nishitani C, Ogawa K. 2002. Lead, chemical porphyria Porphyria

comes in a winter storm to show her devotion, and her lover strangles her with her own tresses. [Br. Poetry: Browning Porphyria’s Lover in Magill IV, 247]

See : Love, Unrequited
, and heme as a biological mediator. Tohoku J Exp Med 196(2):53-64.

Hsieh L, Liou S, Chen Y, Tsai L, Yang T, Wu T. 2000. Association between aminolevulinate dehydrogenase dehydrogenase /de·hy·dro·gen·ase/ (de-hi´dro-jen-as?) an enzyme that catalyzes the transfer of hydrogen or electrons from a donor, oxidizing it, to an acceptor, reducing it.

de·hy·dro·gen·ase
n.
 genotype and blood lead levels in Taiwan. J 0ccup Environ Med 42(2):151-155.

Hu J, Little J, Xu T, Zhao X, Guo L, Jia X, et al. 1999. Risk factors for meningioma in adults: a case-control study in northeast China. Int J Cancer 83(3):299-304.

IARC. 1987. Overall Evaluations of Carcinogenicity carcinogenicity /car·ci·no·ge·nic·i·ty/ (kahr?si-no-je-nis´i-te) the ability or tendency to produce cancer.

carcinogenicity

the ability or tendency to produce cancer.
: An Updating of IARC Monographs Volumes 1 to 42. IARC Monogra Eval Carcinog Risks Hum (suppl 7):1-440.

Inskip PD, Tarone RE, Hatch EE, Wilcosky TC, Shapiro WR, Selker RG, et al. 2001. Cellular-telephone use and brain tumors. N Engl J Med 344(2):79-86.

Kelada S, Shelton E, Kaufmann R, Khoury M. 2001. Delta-aminolevulinic acid dehydratase genotype and lead toxicity: a HuGE review. Am J Epidemiol 154(1):1-13.

Miettinen O. 1985. Theoretical Epidemiology: Principles of Occurrence Research in Medicine. New York:John Wiley & Sons.

Navas-Acien A, Pollan Pol´lan

n. 1. (Zool.) A lake whitefish (Coregonus pollan), native of Ireland. In appearance it resembles a herring.
 M, Gustavsson P, Plato N. 2002. Occupation, exposure to chemicals and risk of gliomas and meningiomas in Sweden. Am J Ind Med 42:214-227.

Preston-Martin S, Mack WJ. 1996. Neoplasms of the nervous system. In: Cancer Epidemiology and Prevention (Schottenfeld D, Fraumeni JF, eds). New York:Oxford University Press, 1231-1281.

Rajaraman P, De Roos A, Stewart P, Linet M, Fine H, Shapiro W, et al. 2004. Occupation and risk of meningioma and acoustic neuroma in the United States. Am J Ind Med 45(5):395-407.

Shen X, Wu S, Yan C, Zhao W, Ao L, Zhang Y, et al. 2001. Delta-aminolevulinate dehydratase polymorphism and blood lead levels in Chinese children. Environ Res 85(3):185-190.

Silbergeld E. 2003. Facilitative mechanisms of lead as a carcinogen carcinogen: see cancer.
carcinogen

Agent that can cause cancer. Exposure to one or more carcinogens, including certain chemicals, radiation, and certain viruses, can initiate cancer under conditions not completely understood.
. Mutat Res 533(1-2):121-133.

Steenland K, Boffetta P. 2000. Lead and cancer in humans: where are we now? Am J Ind Med 38(3):295-299.

Wetmur JG, Lehnert G, Desnick RJ. 1991. The delta-aminolevulinate dehydratase polymorphism: higher blood lead levels in lead workers and environmentally exposed children with the 1-2 and 2-2 isozymes. Environ Res 56(2):109-119.

Wrensch M, Minn Y, Chew T, Bondy M, Berger MS. 2002. Epidemiology of primary brain tumors: current concepts and review of the literature. Neuro-oncol 4(4):278-299.

Ziemsen B, Angerer J, Lehnert G, Benkmann H, Goedde H. 1986. Polymorphism of delta-aminolevulinic acid dehydratase in lead-exposed workers. Int Arch Occup Environ Health 58(3):245-247.

Preetha Rajaraman, (1) Brian S. Schwartz, (2) Nathaniel Rothman, (1) Meredith Yeager, (3) Howard A. Fine, (4) William R. Shapiro, (5) Robert G. Selker, (6) Peter M. Black, (7) and Peter D. Inskip (1)

(1) Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health, Department of Health and Human Services Noun 1. Department of Health and Human Services - the United States federal department that administers all federal programs dealing with health and welfare; created in 1979
Health and Human Services, HHS
, Bethesda, Maryland, USA; (2) Johns Hopkins Bloomberg School of Public Health The Johns Hopkins Bloomberg School of Public Health is part of Johns Hopkins University in Baltimore, Maryland, U.S. It was the first institution of its kind in the world.

Founded in 1916 by William H. Welch and John D.
, Baltimore, Maryland, USA; (3) Core Genotyping Facility, and (4) Neuro-oncology Branch, National Cancer Institute, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland, USA; (5) Barrow Neurological Institute, St. Joseph's Hospital and Medical Center St. Joseph's Hospital and Medical Center is a hospital in Phoenix, Arizona, USA. It is currently operated by Catholic Healthcare West. Services
St. Joseph's is a certified level I trauma center for adults.
, Phoenix, Arizona, USA; (6) Western Pennsylvania Hospital, Pittsburgh, Pennsylvania, USA; (7) Brigham and Women's Hospital Brigham and Women's Hospital (BWH) is a hospital in the Longwood Area of the Boston, Massachusetts neighborhood of Mission Hill. With Massachusetts General Hospital, it is one of the two founding members of Partners HealthCare. , Boston, Massachusetts, USA

Address correspondence to P. Rajaraman, REB, National Cancer Institute, NIH "Not invented here." See digispeak.

NIH - The United States National Institutes of Health.
, DHHS DHHS Department of Health & Human Services (US government)
DHHS Dana Hills High School (Dana Point, California)
DHHS Deaf and Hard of Hearing Services
DHHS Deaf and Hard of Hearing Services
, 6120 Executive Blvd., EPS (Encapsulated PostScript) A PostScript file format used to transfer a graphic image between applications and platforms. EPS files contain PostScript code as well as an optional preview image in TIFF, WMF, PICT or EPSI, the latter being an ASCII-only format.  Room 7085, Bethesda, MD 20892-7238 USA. Telephone: (301) 496-8847. Fax: (301) 402-0207. E-mail: rajarama@mail.nih.gov
Table 1. Demographic characteristics for individuals with glioma,
meningioma, and acoustic neuroma and frequency-matched controls (a)
for genotyped individuals: NCI adult brain tumor study, 1994-1998.

                        Glioma cases     Meningioma
Characteristic           (n = 355)     cases (n = 151)

Sex
  Male                   192 (54.1)       32 (21.2)
  Female                 163 (45.9)      119 (78.8)
Race/ethnicity
  White, non-Hispanic    323 (91.0)      123 (81.5)
  Hispanic                19  (5.4)       12  (8.0)
  Black                    7  (2.0)        9  (6.0)
  Other                    6  (1.7)        7  (4.6)
Mean age (years)            51.3            55.0
Hospital site
  Phoenix, AZ            162 (45.6)       75 (49.7)
  Boston, MA             126 (35.5)       62 (41.1)
  Pittsburgh, PA          67 (18.9)       14  (9.3)

                        Acoustic neuroma   Controls
Characteristic           cases (n = 67)    (n = 505)

Sex
  Male                     23 (34.3)       234 (46.3)
  Female                   44 (65.7)       271 (53.7)
Race/ethnicity
  White, non-Hispanic      61 (91.0)       450 (89.1)
  Hispanic                  5  (7.5)        36  (7.1)
  Black                     0  (0.0)        11  (2.2)
  Other                     1  (1.5)         8  (1.6)
Mean age (years)             51.6             49.4
Hospital site
  Phoenix, AZ              49 (73.1)       258 (51.1)
  Boston, MA               18 (26.8)       164 (32.5)
  Pittsburgh, PA            0  (0.0)       83  (16.4)

Values are no. (%) except where indicated.

(a) Controls were matched to the total case group including glioma,
meningioma, and acoustic neuroma.

Table 2. Association of ALAD2 polymorphism (ALAD1-2 or ALAD2-2) with
risk of glioma, meningioma, and acoustic neuroma: NCI adult brain
tumor study, 1994-1998. (a)

                     Glioma
                    (n = 355)

          No. (%) (b)      OR (95% CI)

ALAD1-1   301 (84.8)    1.0
ALAD1-2    53 (14.9)    0.9 (0.6-1.3) (c)
ALAD2-2     1 (0.3)

                  Meningioma
                   (n = 151)

            No. (%)       OR (95% CI)

ALAD1-1   116 (76.8)   1.0
ALAD1-2    32 (21.2)   1.6 (1.0-2.6) (c)
ALAD2-2     3 (2.0)

              Acoustic neuroma              Control
                  (n = 67)                 (n = 505)

           No. (%)       OR (95% CI)       No. (%)

ALAD1-1   57 (85.1)   1.0                 420 (83.2)
ALAD1-2   10 (14.9)   0.9 (0.4-1.9) (c)    79 (15.6)
ALAD2-2    0                                6 (1.2)

(a) Models adjusted for matching factors (hospital, sex,
race/ethnicity, age, residential proximity to hospital); results are
only reported if number of exposed cases is [greater than or equal
to] 5. (b) Percentages based on genotyped samples. (c) Estimates are
for having [greater than or equal to] 1 copy of the ALAD2 allele.
COPYRIGHT 2005 National Institute of Environmental Health Sciences
No portion of this article can be reproduced without the express written permission from the copyright holder.
Copyright 2005, Gale Group. All rights reserved. Gale Group is a Thomson Corporation Company.

 Reader Opinion

Title:

Comment:



 

Article Details
Printer friendly Cite/link Email Feedback
Title Annotation:Research / Environmental Medicine
Author:Inskip, Peter D.
Publication:Environmental Health Perspectives
Date:Sep 1, 2005
Words:3789
Previous Article:Meeting report: summary of IARC Monographs on formaldehyde, 2-butoxyethanol, and 1-tert-butoxy-2-propanol.(Research)
Next Article:Local variations in CO and particulate air pollution and adverse birth outcomes in Los Angeles County, California, USA.(Research / Children's Health)
Topics:



Related Articles
From fleas to brain tumors.(use of home flea-and-tick foggers during pregnancy linked to brain tumors in children)(Brief Article)
Hindering glutamate slows rat brain cancer.(Brief Article)
Brain tumors. (Update).
National Cancer Institute brain tumor study in adults. (Cancer Awareness).(risk for developing brain tumors)
Cleaning up glutamate slows deadly brain tumors.(Cancer)
State of stem: prop. 71 funding spurs range of activity on cell frontier.(Stem Cell Research--Under the Microscope)
Gliomas and farm pesticide exposure in women: the Upper Midwest Health Study.(Research: Article)
Risk of brain tumors in children and susceptibility to organophosphorus insecticides: the potential role of paraoxonase (PON1).(Research / Children's...
When lead goes to your head: genotype may link exposure and meningioma.(Environews/ Science Selections)
Near and not-so-dear TRI facilities: prenatal proximity and later brain cancer.(Science Selections)

Terms of use | Copyright © 2009 Farlex, Inc. | Feedback | For webmasters | Submit articles